Biofilter Media Selection for Largemouth Bass- Biofilm Characteristics and Growth Performance
Largemouth bass (Micropterus salmoides), also known as California bass, belongs to Actinopterygii, Perciformes, Centrarchidae, Micropterus. It is native to California, USA, and has advantages such as fast growth, delicious taste, rich nutrition, and high economic value. It has become one of the important freshwater aquaculture species in China. In recent years, against the backdrop of fishery transformation and upgrading and the vigorous development of digital and intelligent fisheries, industrialized recirculating aquaculture has gradually emerged. The aquaculture mode of largemouth bass is also shifting from traditional pond culture to green and efficient recirculating aquaculture mode. Recirculating aquaculture has advantages such as water and land saving, high stocking density, and convenient management. Through physical, biological, chemical methods and equipment, solid suspended solids and harmful substances in the water body are removed or converted into harmless substances, so that the water quality meets the normal growth needs of the cultured species, thereby realizing the recycling of water under high-density aquaculture conditions. It has achieved good economic benefits in multiple cultured species.
Currently, research on recirculating aquaculture of largemouth bass mainly focuses on reproduction, feed nutrition, strain selection, precise feeding, water environment changes, and nutritional quality. Research on indoor industrialized recirculating aquaculture of largemouth bass mainly focuses on the cultivation of large-sized juvenile fish, and full-cycle adult fish farming has not been widely promoted. The main challenge faced by largemouth bass recirculating aquaculture is maintaining a good water environment under high-density conditions to ensure the normal growth of the cultured species. Water treatment is the core of recirculating aquaculture, and efficient water treatment biofilter media are the foundation of the water treatment system. Although there are many reports on water purification by biofilter media, reports specifically on largemouth bass industrialized recirculating aquaculture, especially regarding the screening of effective water treatment biofilter media, the microbial community structure of biofilms on different biofilter media, treatment effects, and impacts on the growth of the cultured species, are lacking. Three types of biofilter media were selected, among which the square sponge and fluidized bed ball biofilter media are low-cost and simple to operate, and have been widely used in aquaculture tail water treatment; Mutag Biochip 30 (abbreviated as Biochip) is a new type of biofilter media that has emerged in recent years, with advantages of impact resistance and long service life, but its practical application effects have not been reported. For this purpose, 16S rDNA high-throughput sequencing technology was used to analyze the biofilm formation situation of the three water treatment biofilter media, while simultaneously analyzing the growth situation of largemouth bass, in order to screen out practical water treatment biofilter media and provide efficient water treatment media for largemouth bass industrialized recirculating aquaculture.
1. Materials and Methods
1.1 Test Materials
The biofilter media selected for this test were square sponge, Biochip, and fluidized bed ball, as shown in Figure 1. The square sponge material is polyurethane, shaped as a cube with a side length of 2.0 cm, specific surface area (3.2~3.5)×10⁴ m²/m³. The Biochip material is polyethylene, shaped as a circle with a diameter of 3.0 cm, thickness about 0.11 cm, specific surface area 5.5×10³ m²/m³. The fluidized bed ball material is polyethylene, effective specific surface area 500~800 m²/m³.
1.2 Experimental Grouping
The square sponge biofilter media treatment group was set as group T1, the corresponding media biofilm was labeled B1, and the corresponding aquaculture water was labeled W1; the Biochip biofilter media treatment group was set as group T2, the corresponding media biofilm was labeled B2, and the corresponding aquaculture water was labeled W2; the fluidized bed ball biofilter media treatment group was set as group T3, the corresponding media biofilm was labeled B3, and the corresponding aquaculture water was labeled W3.
1.3 Aquaculture System
The experiment was conducted in a recirculating aquaculture system at the Balidian Comprehensive Experimental Base of Zhejiang Institute of Freshwater Fisheries. There were 9 culture tanks in total, volume 500 L, effective water volume 350 L. The biofilter tank was made of a plastic aquarium measuring 80 cm long, 50 cm wide, and 50 cm high, volume 200 L, effective water volume 120 L. The culture tank and biofilter tank were connected by a water pump to form an internal circulation, flow rate 3~4 L/min, with aeration for oxygenation, water dissolved oxygen maintained above 5 mg/L. The biofilter media were randomly grouped, each type of biofilter media had 3 replicates, each biofilter tank was loaded with 2.0 kg of biofilter media, while simultaneously suspending a slow-release carbon source. During the biofilm culture period, 10% of the water was changed daily. Initial water quality indicators: Total Nitrogen (TN) 9.41 mg/L, Total Phosphorus (TP) 1.02 mg/L, Ammonia Nitrogen (TAN) 1.26 mg/L, Nitrite Nitrogen (NO₂⁻-N) 0.04 mg/L, Permanganate Index (CODₘₙ) 3.73 mg/L.
1.4 Test Fish and Culture Management
Largemouth bass was used as the cultured species. Before the start of the test, they were acclimated in the recirculating water for 7 days. The test was conducted from August 11, 2022, to September 22, 2022, lasting for 42 days. Largemouth bass without surface injuries, healthy and lively, were selected for grouping, 60 fish were stocked in each culture tank, fed twice daily, feeding times were 07:00 in the morning and 16:00 in the afternoon, daily feeding amount accounted for about 1.0%~1.5% of the total fish body mass. The initial body mass of the test fish was (20.46 ± 0.46) g.
1.5 Sample Collection
Water samples from the biofilter tank were collected every 2 days, recording indicators such as water temperature, dissolved oxygen, pH value, and measuring ammonia nitrogen and nitrite nitrogen. Feeding amount, fish body mass at the start and end of the experiment, and survival rate were recorded. After the experiment, 1 L of water from each culture tank was collected using sterile water collection bags, filtered through a 0.22 µm filter membrane, and stored in a -80 °C freezer for later use. Biofilter media samples of 0.5 g were taken aseptically from each biofilter tank, stored in sterilized distilled water, shaken vigorously to dislodge microorganisms from the biofilm surface, then filtered through a 0.22 µm filter membrane and stored in a -80 °C freezer for later use.
1.6 Measurement Methods
1.6.1 Water Quality Measurement
Water temperature, dissolved oxygen, and pH value were detected using a HACH Hq40d portable water quality analyzer. Ammonia nitrogen concentration was measured using the Nessler's reagent spectrophotometric method. Nitrite nitrogen concentration was detected using the hydrochloric acid naphthylethylenediamine spectrophotometric method.
1.6.2 Aquaculture Performance Measurement
The calculation formulas for the weight gain rate, feed conversion ratio, and survival rate of the fish are as follows.
l Weight Gain Rate = (Final fish body mass - Initial fish body mass) / Initial body mass × 100%;
l Feed Conversion Ratio = Feed consumption / Weight gain;
l Survival Rate = (Number of fish at the end of the experiment / Initial number of fish at the start of the experiment) × 100%.
1.6.3 Microbial High-Throughput Sequencing
Bacterial DNA was extracted from water and biofilm using a Bacterial DNA Extraction Kit (OMEGA Biotech, USA). Specific primers 338F (5'–ACTCCTACGGGAGGCAGCAG–3') and 806R (5'–GGACTACHVGGGTWTCTAAT–3') were used to amplify the V3 and V4 regions of the bacterial 16S rDNA. PCR used the TransGen AP221-02 reaction system: 4 µL of 5×FastPfu Buffer, 2 µL of 2.5 mmol/L dNTPs, 0.4 µL of FastPfu Polymerase, 0.8 µL each of 5 µmol/L forward and reverse primers, 0.2 µL of BSA, 10 ng of DNA template, supplemented with ddH₂O to 20 µL. PCR reaction conditions: 95 °C for 3 min; 95 °C for 30 s, 53 °C for 45 s, 72 °C for 1 min, 28 cycles; 72 °C extension for 10 min. PCR amplification was performed on a PCR reaction instrument 9700 (Applied Biosystems® GeneAmp®, USA). PCR products were purified using Beads and then subjected to sequencing. Sequencing was commissioned to Shanghai Majorbio BioPharm Technology Co., Ltd.
1.6.4 Microbial Diversity Analysis
The raw data obtained from sequencing were first spliced, followed by quality control filtering of the reads quality and splicing effect, and sequence direction correction, resulting in optimized data. After normalizing the finally obtained Clean data, OTU (Operational Taxonomic Units) clustering analysis and taxonomic analysis were performed at 97% similarity. Histograms of the samples were drawn using Excel, and heat maps were drawn using the Majorbio Cloud Platform.
1.7 Data Analysis
SPSS 16.0 statistical software was used for significance analysis of differences, and Duncan's method in analysis of variance (ANOVA) was used for multiple comparisons.
2. Results and Analysis
2.1 Biofilm Formation Time of Different Biofilter Media
As shown in Figure 2, under natural biofilm formation conditions, the ammonia nitrogen content in the water of the biofilter tank showed a trend of rapid rise followed by gradual decline. The ammonia nitrogen content in the water of the biofilter tank corresponding to the square sponge reached its peak at 17 days, at 8.13 mg/L, then gradually decreased, reaching the lowest at 41 days, afterwards remaining around 0.20 mg/L, indicating that the biofilm formation time for the square sponge was about 17 days. The changes in ammonia nitrogen content in the water of the biofilter tanks corresponding to Biochip and the fluidized bed ball were basically the same, showing fluctuating changes. The ammonia nitrogen peak appeared at 21 days, at 7.88 mg/L and 7.57 mg/L respectively, indicating that the biofilm formation time for Biochip and the fluidized bed ball biofilter media was about 21 days. The ammonia nitrogen content in the biofilter tanks corresponding to these two media dropped to the lowest at 43 days and 45 days respectively.
2.2 Changes in Water pH Value in Different Culture Tanks
From Figure 3, it can be seen that the initial pH value of the culture water was 7.3. As the culture time extended, the pH value of the water in each culture tank showed a downward trend. After 12 days, the pH value of all culture tanks was less than 6.0, which is unfavorable for the growth of the cultured species. Therefore, after 12 days of biofilm formation, attention should be paid to adjusting the pH value of the culture tank water.
2.3 Analysis of Microbial Community Composition on Biofilms of Different Biofilter Media and in Water
2.3.1 Microbial Community Composition at Phylum Level
As shown in Figure 4, at the phylum level, the dominant bacteria on the biofilms of the three biofilter media were the same, all being Proteobacteria, Actinobacteriota, Bacteroidota, and Chloroflexi. Their combined relative abundances were 68.96%, 64.74%, and 65.45% respectively. The dominant bacteria in the corresponding culture water were different. The dominant bacteria in W1 was Actinobacteriota, with a relative abundance of 64.66%. The dominant bacteria in W2 and W3 were Proteobacteria, with relative abundances of 34.93% and 50.10% respectively.
Fig. 4 Community composition of bacteria in different biofilm and water at phylum level
2.3.2 Microbial Community Composition at Family Level
As shown in Figure 5, on the biofilms of the three media, about 48% of the bacteria were bacterial communities with relative abundances all less than 3%. The dominant bacteria of B1 and B2 were the same, both being Xanthomonadaceae, with relative abundances of 11.64% and 9.16% respectively; the dominant bacteria of B3 was JG30-KF-CM45, with a relative abundance of 10.54%. The dominant bacteria in the culture water were different from those on the biofilter media. Microbacteriaceae was the absolute dominant bacteria in W1, with a relative abundance of 62.10%; the dominant bacteria in W2, besides Microbacteriaceae (13.82%), also included a certain proportion of Rhizobiales (8.57%); the dominant bacteria in W3 was Rhizobiales, with a relative abundance of 38.94%, followed by Flavobacteriaceae, with a relative abundance of 15.89%.
The top 50 species at the genus level were counted. After processing the numerical values, the abundance changes of different species in the samples were displayed through the color gradient of the color blocks. The results are shown in Figure 6. Leifsonia was the dominant bacteria in W1, with a relative abundance of 56.16%; the dominant bacteria in W2 were Leifsonia (10.30%) and Rhizobiales_Incertae_Sedis (8.47%); the dominant bacteria in W3 was Rhizobiales_Incertae_Sedis, with a relative abundance of 38.92%. Among the identifiable bacteria on the biofilms, Thermomonas was the dominant genus in B1, with a relative abundance of 4.71%; the dominant genera in B2 and B3 were Nitrospira, with relative abundances of 4.41% and 2.70% respectively.
Fig. 5 Community composition of bacteria in different biofilm and water at family level
Fig. 6 Heatmap of bacterial community composition in different biofilm and water at genus level
2.4 α-Diversity Analysis of Microbial Communities on Biofilms of Different Biofilter Media and in Water
As shown in Table 1, the Shannon index of the microbial communities on the biofilms of different media was greater than that of the corresponding culture water, while the Simpson index was the opposite. Analyzing the corresponding culture water, the bacterial community Shannon index of W2 was the highest, significantly higher than that of W1 and W3, while the Simpson index was significantly lower than that of W1 and W3, indicating its α-diversity was the highest. Different from the α-diversity of the culture water, although the bacterial microbial community Shannon index in the B2 media was the largest and the Simpson index was the smallest, there was no significant difference among the three biofilter media. The sequencing coverage of all samples was above 0.990, indicating that the sequencing depth could reflect the true level of the samples.
2.5 Effects of Different Biofilter Media on the Growth of Largemouth Bass
Table 2 shows the growth situation of largemouth bass in the different biofilter media groups. After 44 days of culture, the final body mass and weight gain rate of largemouth bass in the square sponge culture group were significantly higher than those in the fluidized bed ball and Biochip groups, and the feed conversion ratio was significantly lower than that of the other groups. The survival rate of largemouth bass in each group was above 97%, with no significant difference among the groups.
3. Conclusion and Discussion
3.1 Biofilm Formation Time of Different Biofilter Media
Biofilms attach to the surface of biofilter media. The material, structure, and specific surface area of the biofilter media are the main factors affecting biofilm formation. There are two common methods for biofilm cultivation: the natural biofilm formation method and the inoculated biofilm formation method. Different biofilm formation methods affect the maturation time of the biofilm. Hu Xiaobing et al. used four different methods for biofilm formation, and the results showed that when using methods such as adding chitosan, iron ions, and inoculating with discharged sludge for biofilm formation, the maturation time of the biofilm was shorter than that of the natural biofilm formation method. Although adding beneficial microorganisms or active substances can shorten the biofilm formation time, there are problems such as difficulty in obtaining the inoculum, complex process construction, and high cost. Guan Min et al., under conditions of low organic matter content, directly used raw water for biofilm formation, and the biofilter tank successfully started up through natural biofilm formation after about 38 days. This research result is similar to the results of this study. The results of this study show that under the same biofilm formation conditions, the biofilm formation time of the square sponge was shorter than that of the other two biofilter media. This may be related to the large specific surface area, strong hydrophilicity, and ease of biofilm attachment of the square sponge. The specific surface area of the square sponge is as high as 32,000~35,000 m²/m³, much larger than the other two media. Furthermore, the material of the square sponge is polyurethane, which expands when exposed to water, has high hydrophilicity, and is conducive to the attachment and growth of microorganisms in the water. The research results of Li Yong et al. also showed that the start-up performance and ammonia nitrogen removal performance of polyurethane sponge were better than those of polypropylene, which is consistent with the results of this study. Additionally, in this study, the specific surface area of the Biochip biofilter media was as high as 5,500 m²/m³, much larger than that of the fluidized bed ball biofilter media, but the biofilm formation time was basically the same as that of the fluidized bed ball media. This may be related to the pore size. Some studies have pointed out that the internal spatial scale of biofilter media affects the growth of biofilms. Although some biofilter media have a large specific surface area, their pores are fine, and the pore size is much smaller than the thickness of the mature biofilm, which can easily lead to pore blockage, making it difficult for the biofilm in the pores to reach maximum accumulation. The pores of the Biochip are small, resulting in slower biofilm growth and longer biofilm formation time.
3.2 Microbial Community Composition of Biofilter Media and Culture Water
In this study, the dominant bacteria on the biofilter media and in the corresponding culture water were different. The Shannon index of the biofilms on the biofilter media was greater than that of the corresponding culture water, indicating that the biofilter media have the effect of enriching microorganisms. This is consistent with the research results of Hu Gaoyu et al. There are many factors affecting the microbial community structure, such as carrier type, filter depth, salinity, organic matter concentration, etc. The same biofilter media, under different culture conditions, will have different microbial communities on the biofilm. The author once studied the biofilm formation situation of fluidized bed ball biofilter media in a recirculating aquaculture system for giant freshwater prawn (Macrobrachium rosenbergii). The results showed that the dominant phylum on its biofilm was Firmicutes, whereas in this study, the dominant phylum on the fluidized bed ball biofilm was Proteobacteria. The main reason for this difference may be the different aquaculture environments. The three biofilter media used in this study had the same initial conditions for cultivating biofilms. It is possible that due to the different physical characteristics of the media, the formed biofilm thickness and internal environment were also different, resulting in differences in the microbial communities. Therefore, the difference in carriers is the main reason for the differences in microbial communities. Furthermore, during the aquaculture process, the water environment and the microbial community influence each other. The reasons for the differences in microbial communities may be related to environmental factors. For example, Yuan Cuilin's research indicated that the total number of heterotrophic bacteria in the body; Fan Tingyu et al. believed that pH value can significantly affect the total nitrogen content in water, and plays a key role in the distribution of aquatic bacterial communities in inland river sections. Ammonia nitrogen, total phosphorus, and chlorophyll a also influence the composition of bacterial communities in the water body to varying degrees. The environmental factors causing the differences in microbial community composition in this study still need further confirmation.
3.3 Effects of Different Biofilter Media on the Growth of Largemouth Bass
From the growth results, the largemouth bass in the square sponge group grew the fastest, with a weight gain rate significantly higher than that of the other two media, and the lowest feed conversion ratio. This is consistent with previous research results. In this study, biofilm formation and aquaculture were conducted simultaneously. Judging from the biofilm formation time, the square sponge biofilm matured earlier, and after the biofilm matured, the concentrations of ammonia nitrogen and nitrite nitrogen in the water were always lower than those of the other two media. Additionally, the square sponge has a certain filtration capacity, the content of solid suspended solids in the culture water was lower, and the water was relatively clear. The better growth of largemouth bass in the square sponge group may be related to the good water quality. However, the purification effects of the square sponge media on total nitrogen, total phosphorus, and permanganate index in the water need further study. It is worth noting that during the experiment, the pH value showed an overall downward trend. After 12 days of culture, the pH value of all culture tanks was less than 6.0, which is consistent with the research results of Zhang Long et al. The decrease in pH value is because a large number of hydrogen ions are produced during the process of cultivating the biofilm, leading to a decrease in the water pH value. Therefore, during the biofilm formation process, it is necessary to promptly adjust the pH value of the culture tank water to ensure it is within the normal growth range of the cultured species. Considering economic cost, the market price of square sponge is 70~100 RMB/kg, and its cost is between the other two biofilter media. Combined with the growth results, in the short term, the square sponge is a relatively practical water treatment biofilter media for recirculating aquaculture. However, the square sponge has poor toughness and a short service life. Its long-term use effects and aquaculture effects need further verification.
In summary, under natural biofilm formation conditions, the square sponge biofilter media has the shortest biofilm formation time, a moderate price, and the final body mass and weight gain rate of largemouth bass in the square sponge group were significantly higher than those of the other two biofilter media. In the short term, it is a relatively practical water treatment biofilter media for recirculating aquaculture.